View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9289_high_8 (Length: 222)
Name: NF9289_high_8
Description: NF9289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9289_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 50214358 - 50214558
Alignment:
| Q |
7 |
caatgagatggacatcaagtctagtaacaatttacataagggctagttctatatgctttgctacacatcgtatatcaatttcagagcattcaatttcaat |
106 |
Q |
| |
|
|||| |||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214358 |
caattagatagacagcaagtctagtaacaatttacataagggctagttcaatatgctttgctacacatcgtatatcaatttcagagcattcaatttcaat |
50214457 |
T |
 |
| Q |
107 |
tctctcttctaaaactccattgttgcaacaagtattatatcagagatatatattattcatggtcacttaatataacaaacccgcacttcaattttacctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214458 |
tctctcttctaaaactccattgttgcaacaagtattatatcagagatatatattattcatggtcacttaatataacaaacccgcacttcaattttacctt |
50214557 |
T |
 |
| Q |
207 |
t |
207 |
Q |
| |
|
| |
|
|
| T |
50214558 |
t |
50214558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University