View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9289_low_10 (Length: 318)
Name: NF9289_low_10
Description: NF9289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9289_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 269
Target Start/End: Complemental strand, 4786786 - 4786530
Alignment:
| Q |
14 |
agaccgtgagataaattcaattaaatccagaacacttatatgcaagtaaagttttaatacgaggaatttactagatatatataacc-taataaaattcct |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4786786 |
agaccgtgagataaattaaattaaatccagaacatttatatgcaagtaaagttttaatacgaggaatttactagatatatataaccataataaaattcct |
4786687 |
T |
 |
| Q |
113 |
tttctttttatgctcaaaaatttgaaaggttttcttttgaagagctaaagcctgcttgattaaataggtagaacataaacaaatctagatttttacattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4786686 |
tttctttttatgctcaaaaatttgaaaggttttcttttgaagagctaaagcctgcttgattaaataggtagaacataaacaaatctagatttttacattc |
4786587 |
T |
 |
| Q |
213 |
cttcatggtgctggcttggaaattatgagtgtatcaaagtggaaaggcatacttcaa |
269 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4786586 |
cttcatagtgctggcttggaaattatgagggtatcaaagtggaaaggcatacttcaa |
4786530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 302
Target Start/End: Complemental strand, 4786400 - 4786364
Alignment:
| Q |
266 |
tcaatttgccgcagtagcaaaaacattctcacctatt |
302 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4786400 |
tcaatttgccgcaatagcaaaaacattctcacctatt |
4786364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University