View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9289_low_15 (Length: 273)
Name: NF9289_low_15
Description: NF9289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9289_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 49039912 - 49039740
Alignment:
| Q |
19 |
acacctgtgtaccctgtttcgtcctctttttggaacacacaattgtagctcttgtcattggctcctaaatgagttcgaacgctatgaagtaacttgtact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49039912 |
acacctgtgtaccctgtttcgtcctctttttggaacacacaattgtagctcttgtcattggctcctgaatgagttcgaacgctatgaagtaacttgtact |
49039813 |
T |
 |
| Q |
119 |
tggattgggtcctatcaaaggatttattggagagaagtacggcagctcctcccattcggaaaatacaattgga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49039812 |
tggattgggtcctatcaaaggatttattggagagaagtacggcagctcctcccattcggaaaatacaattgga |
49039740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 193
Target Start/End: Original strand, 49041531 - 49041694
Alignment:
| Q |
30 |
ccctgtttcgtcctctttttggaacacacaattgtagctcttgtcattggctcctaaatgagttcgaacgctatgaagtaacttgtacttggattgggtc |
129 |
Q |
| |
|
|||||| || || ||||| ||| | ||||| || ||| ||||||||| |||||| ||| |||||||| |||||| | |||||| ||||| |||| |
|
|
| T |
49041531 |
ccctgtctcatcttctttctggtaaacacagttatagttcttgtcatcagctcctttatgggttcgaactgtatgaacaagcttgtatttggaacgggtt |
49041630 |
T |
 |
| Q |
130 |
ctatcaaaggatttattggagagaagtacggcagctcctcccattcggaaaatacaattggaaa |
193 |
Q |
| |
|
| |||| |||| |||||||| ||||||| ||| || || |||||||||||||| ||||| |||| |
|
|
| T |
49041631 |
cgatcagaggacttattggaaagaagtatggcggcgccacccattcggaaaatgcaattagaaa |
49041694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University