View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9289_low_22 (Length: 243)
Name: NF9289_low_22
Description: NF9289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9289_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 40660578 - 40660809
Alignment:
| Q |
1 |
caaataacaaagacaaccacaatcaagtagacaaaaagtagcagactggcctcattaacatgtgcttcatgcttaattgcaatcataacaaatgtacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660578 |
caaataacaaagacaaccacaatcaagtggacaaaaagtagcagactggcctcattaacatgtgcttcatgcttaattgcaatcataacaaatgtacatg |
40660677 |
T |
 |
| Q |
101 |
atgtctattgtataacaaaccggaggtagtagtaaaaaactagcgcgtaatctataactcctatatctctaagatgttgatcttggttatggctgctgcc |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660678 |
atgtctattgtataaaaaaccggaggtagtagtaaaaaactagcgcgtaatctataactcctatatctctaagatgttgatcttggttatggctgctgcc |
40660777 |
T |
 |
| Q |
201 |
ttttc-attacttcctatttcttctgtgatgt |
231 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| |
|
|
| T |
40660778 |
ttttctattgcttcctatttcttctgtgatgt |
40660809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University