View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9289_low_6 (Length: 403)
Name: NF9289_low_6
Description: NF9289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9289_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Original strand, 29674081 - 29674468
Alignment:
| Q |
1 |
gtccattaagtgaatgagaaatgaggtaattgggctttttgattcattcatggctttgctagcattttgagggg-ggtggacttgtttggtgaagatgat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29674081 |
gtccattaagtgaatgagaaatgaggtaattgggctttttgattcattcatggctttgctagcattttgagggggggtggacttgtttggtgaagatgat |
29674180 |
T |
 |
| Q |
100 |
gaataagtgagtggagaaaccattttgtttgtatttttgtacacgtctaaccccgcgtttttccctctattagagagtgattttcattacacgtggccaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29674181 |
gaataagtgagtggagaaaccattttgtttgtatttttgtacacgtctaaccccgcgtttttccctctattagagagtgattttcattacacgtggccaa |
29674280 |
T |
 |
| Q |
200 |
gtctctcttcttgatttcaccttcaaaaatattggtcacatcatatacattaccccacacgcttgttttgcctccctttaaaccttcctttcttctttca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29674281 |
gtctctcttcttgatttcaccttcaaaaatattggtcacatcatatacattaccccacacgcttgttttgcctccctttaaaccttcctttcttctttca |
29674380 |
T |
 |
| Q |
300 |
tatctcatgcacattatattcatgttttattacttaaatattaaagtctaatttgattaatcaatgtgtctagctcgtgcaatctttt |
387 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29674381 |
tatctcatgcacattatattcatgctttattacttaaatattaaagtctaatttgattaatcaatgtgtctagctcgtgcaatctttt |
29674468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University