View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9289_low_7 (Length: 364)
Name: NF9289_low_7
Description: NF9289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9289_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 17 - 356
Target Start/End: Complemental strand, 40839469 - 40839130
Alignment:
| Q |
17 |
acctatgatgttactaaaggaaccaaaagaggttgcagtcttttacctaccgatattggccttaatgtgtcagatatgtcgattcaacatgatcaagggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839469 |
acctatgatgttactaaaggaaccaaaagaggttgtagtcttttacctaccgatattggccttaatgtgtcagatatgtcgattcaacatgatcaagggt |
40839370 |
T |
|
| Q |
117 |
caaatttttatactatctatgctagattagttttgccttctgataaatataacataacaaggttgaaccatgtttggcaagttgggaataatgttagggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839369 |
caaatttttatactatctatgctagattagttttgccttctgataaatataacataacaaggttgaaccatgtttggcaagttgggaataatgttagggg |
40839270 |
T |
|
| Q |
217 |
tcagagacctttgggccatccaacaactcttcacaatgtagatagcactgagactatagacttgacttcccccgatggtcgcagccggggacagaaactg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
40839269 |
tcagagacctttgggccatccaacaactcttcacaatgtagatagcactgagactatagacttgacttcaaccgatggtcgcagccggggacagaagctg |
40839170 |
T |
|
| Q |
317 |
agtttccttcgatcggtaacaatcctttttcttctctgct |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40839169 |
agtttccttcgatcggtaacaatcctttttcttctatgct |
40839130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University