View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_high_17 (Length: 319)
Name: NF9290_high_17
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 14 - 301
Target Start/End: Original strand, 43450035 - 43450322
Alignment:
| Q |
14 |
cagagaacacggattttgccatccgcttctgaaactccgagccgcgacggagacaccgatgactactctgtttccaacgatttgtttatgccttatgcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450035 |
cagagaacacggattttgccatccgcttctgaaactccgagccgcgacggagacaccggtgactactctgtttccaacgatttgtttatgccttatgcaa |
43450134 |
T |
 |
| Q |
114 |
agttgttatcgagtgtgagcagtgatcaagcgttaaagctgaaggagttggagaaggagtacgaaaaggttttggatgagaattgcagggttcttgctgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43450135 |
agttgttatcgagtgtgagcagtgatcaagcgttaaagctgaaggagttggagaaggagtacgaagaggttttggatgagaattgcagggttcttgctgt |
43450234 |
T |
 |
| Q |
214 |
gtattttaaagaggttttggtgaataaagatgaagattcgacaattagtccaccgttgttgatcttgaagaacgctgcaggaagtggc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450235 |
gtattttaaagaggttttggtgaataaagatgaagattcgacgattagtccaccgttgttgatcttgaagaacgctgcaggaagtggc |
43450322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University