View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_high_18 (Length: 313)
Name: NF9290_high_18
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_high_18 |
 |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 59 - 298
Target Start/End: Complemental strand, 36882957 - 36882715
Alignment:
| Q |
59 |
aacattttagtaaaacttttgcttcatggaagtttctaaaatcaactacatgcatattcttcacctgaaaa-taatggagtaaataggcattttaaattt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| | | || ||||||||||||||| |||||||||||| |
|
|
| T |
36882957 |
aacattttagtaaaacttttgcttcatggaagtttctcaaatcatctacatgcatattcttcactttacaagtaatggagtaaatagacattttaaattt |
36882858 |
T |
 |
| Q |
158 |
ttaatgtttgaattta-tccaagccctgcaaaccctctcaaatctttgttcaat-caacttttgagttctcccaaactaagaagattttgtatcataaag |
255 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
36882857 |
ttaatctttgaattttgtccaagccctgcaaaccctctcaaatctttgttcagtacaacttttaagttctcccaaattaagaagattttgtattataaag |
36882758 |
T |
 |
| Q |
256 |
aaaaataaattccccgaagctcccccctccaaaagtcctcgat |
298 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
36882757 |
aaaaataaattccccaaagctcccccctcccaaagtcctcgat |
36882715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 276
Target Start/End: Complemental strand, 7521 - 7481
Alignment:
| Q |
236 |
gaagattttgtatcataaagaaaaataaattccccgaagct |
276 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7521 |
gaagattttgtattatgaagaaaaataaattccccgaagct |
7481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 276
Target Start/End: Original strand, 11229298 - 11229338
Alignment:
| Q |
236 |
gaagattttgtatcataaagaaaaataaattccccgaagct |
276 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11229298 |
gaagattttgtattatgaagaaaaataaattccccgaagct |
11229338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University