View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_high_20 (Length: 308)
Name: NF9290_high_20
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 104 - 293
Target Start/End: Original strand, 32652095 - 32652284
Alignment:
| Q |
104 |
atatgctacaaattgtcaaaattctatttgtaccgaaaagctaatccctttccacctctaatttttatctggttatagaccttttcgtcgaaaagggtaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32652095 |
atatgctacaaattgtcaaaattctatttgtaccgaaaagctaatccctttccacctctaatttttatctggttatagactttttcgtcgaaaagggtaa |
32652194 |
T |
 |
| Q |
204 |
tgatttcttaaacatttctgaggatgtaaatacttaatagttgtttcaagttcagcattttagcattgcatcctgaattgatgagcatga |
293 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32652195 |
tgatttcttaaacatttccgaggatgtaaatagttaatagttgtttccagttcagcattttagcattgcatcctgaattgatgagcatga |
32652284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 32652053 - 32652099
Alignment:
| Q |
18 |
tcatataattacagtgaagtaaatgattttcttaaattattaatatg |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32652053 |
tcatataattacagtgaagtaaatgattttcttaaattattaatatg |
32652099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 102
Target Start/End: Original strand, 17177100 - 17177138
Alignment:
| Q |
64 |
gtcgtatctagtgtctgtgtccgtatccgtacttcatag |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
17177100 |
gtcgtatctggtgtctgtgtccgtatccgtgcttcatag |
17177138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 70 - 102
Target Start/End: Complemental strand, 30183525 - 30183493
Alignment:
| Q |
70 |
tctagtgtctgtgtccgtatccgtacttcatag |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
30183525 |
tctagtgtctgtgtccgtatccgtccttcatag |
30183493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University