View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9290_high_25 (Length: 259)

Name: NF9290_high_25
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9290_high_25
NF9290_high_25
[»] chr4 (2 HSPs)
chr4 (1-102)||(49023800-49023901)
chr4 (158-248)||(49023671-49023759)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 49023901 - 49023800
Alignment:
1 gttcttcctatggctatgatgataaccaagttttctagagacgccatccgaagatttcagacagcaacatttaccatgaacacaacccatgtttcaaaca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
49023901 gttcttcctatggctatgatgataaccaagttttctagagacgccacccgaagatttcagacagcaacatttaccatgaacacaacccatgtttcaaaca 49023802  T
101 gg 102  Q
    ||    
49023801 gg 49023800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 248
Target Start/End: Complemental strand, 49023759 - 49023671
Alignment:
158 ttgttgtaaacaagacatgaaaccgaaagcattgnnnnnnnnnnncaaaagtttacaggaagttgtaactcctctgcaatgtaacaccaaa 248  Q
    ||||| ||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||| |||||    
49023759 ttgttataaacaagacatgaaaccgaaagcattgaaagaaaaaa--aaaagtttacaggaagttgtaactcctctgcaatgtaactccaaa 49023671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University