View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9290_high_42 (Length: 218)

Name: NF9290_high_42
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9290_high_42
NF9290_high_42
[»] chr3 (1 HSPs)
chr3 (1-206)||(47578826-47579031)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 47579031 - 47578826
Alignment:
1 tgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggaccgtgatttcttgttgttgttgccgccatcaccgccacccccagcat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| || |||||||    
47579031 tgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggactgtgattttttgttgttgttgccgccatcaccgccgccaccagcat 47578932  T
101 tatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgttatcaagtggaaactgctgtttagtttcttttgaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
47578931 tatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgctatcaagtggaaactgctgtttagtttcttttgaaa 47578832  T
201 aaactg 206  Q
    ||||||    
47578831 aaactg 47578826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University