View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_10 (Length: 505)
Name: NF9290_low_10
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 13 - 333
Target Start/End: Original strand, 24998556 - 24998876
Alignment:
| Q |
13 |
taatgttctctgttagtatacaggggttatatacttttagtgatttggttgaagggcatggggaacaatgaaggtaatgataagtttctctttaatttca |
112 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24998556 |
taatgttctctgtcggtatccaggggctatatactcttagtgatttggttgaagggcatggggaacaatgaaggtaatgataagtttctctttaatttca |
24998655 |
T |
 |
| Q |
113 |
ctgttatatgagagtaattgatgttaagcttttatgtctgatttacnnnnnnnnattgtggtttggaaatcacaattacaaccaccacacatggttacat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
24998656 |
ctgttatatgagagtaattgatgttaagtttttatgtctgatttacttttttttattgtggtttggaaatcacaattacaactaccacacacggttacat |
24998755 |
T |
 |
| Q |
213 |
aatttcttttcttaattgcagtttacaatcacataaactggaaaatcaaatatgaaatttgatggtaatttgtgatctgtttatttgcttcaaagtttct |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24998756 |
aatttcttttctcaattgcagtttacaatcacataaaccggaaaatcaaatatgaaatttgatggtaatttttgatctgtttatttgcttcaaagtttct |
24998855 |
T |
 |
| Q |
313 |
aacttcttcttacaaactttt |
333 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24998856 |
aacttcttcttacaaactttt |
24998876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University