View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_110 (Length: 224)
Name: NF9290_low_110
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_110 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 33744652 - 33744465
Alignment:
| Q |
14 |
acagatcatgagccaaaaccccctagaaggatttaatccctaattaaaaatgccactaaatttatgtttccttgtctttttcatgtaatgcatgcatgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33744652 |
acagatcatgagccaaaaccccctagaaggatttaatccctaattaaaaatgccactaaatttatgtttccttgtctttttcatgtaatgcatgcatgtt |
33744553 |
T |
 |
| Q |
114 |
gttccctttcattaatttaattataacgtgtttgttttgtcacgcctttgtctgctgcttttctattcaaagtcacaaattgtatgta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33744552 |
gttccctttcattaatttaattataacgtgtttgttttgtcacgcctttgtctgctgcttttctattcaaagtcacaaattgtatgta |
33744465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University