View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9290_low_111 (Length: 220)

Name: NF9290_low_111
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9290_low_111
NF9290_low_111
[»] chr6 (1 HSPs)
chr6 (114-220)||(15112857-15112963)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 114 - 220
Target Start/End: Original strand, 15112857 - 15112963
Alignment:
114 atatgagaatagtgtagttacttcgttcatctaataataactattagtaataagataaacaatagcatttcagtacgattacaacgactcaagctaaggt 213  Q
    |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||| |||||||| ||||||||||||  |    
15112857 atatgagaatagtgtagttacttcgttcatctaataataaatagtagtaataagataaacgatagcatttcagtatgattacaatgactcaagctaactt 15112956  T
214 ttactat 220  Q
    |||||||    
15112957 ttactat 15112963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University