View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_113 (Length: 218)
Name: NF9290_low_113
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_113 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 47579031 - 47578826
Alignment:
| Q |
1 |
tgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggaccgtgatttcttgttgttgttgccgccatcaccgccacccccagcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| || ||||||| |
|
|
| T |
47579031 |
tgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggactgtgattttttgttgttgttgccgccatcaccgccgccaccagcat |
47578932 |
T |
 |
| Q |
101 |
tatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgttatcaagtggaaactgctgtttagtttcttttgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47578931 |
tatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgctatcaagtggaaactgctgtttagtttcttttgaaa |
47578832 |
T |
 |
| Q |
201 |
aaactg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
47578831 |
aaactg |
47578826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University