View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_114 (Length: 217)
Name: NF9290_low_114
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_114 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 18474484 - 18474301
Alignment:
| Q |
14 |
cagagaactcgcatctatttgatcattacaaccatttttagcaaatatgaacaaggtttttcttgtgacattgttaacttcagcaagaaagtaactttgg |
113 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18474484 |
cagagaactcacatctatttggtaattacaaccatttttagcaaat--gaacaaggtttttcttgtgacattgttaacttcagcaaaaaagtaactttgg |
18474387 |
T |
|
| Q |
114 |
tcagtttctaacattttcaactgaaccatcctctttccaaattattactttatgatgtatagaggaaggaccaataccaatttcatg |
200 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18474386 |
tcagcttc-aacattttcaaccgaaccatcctctttccaaattattactttatgatgtatagaggaaggaccaataccaattccatg |
18474301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 66 - 115
Target Start/End: Original strand, 20862530 - 20862579
Alignment:
| Q |
66 |
aaggtttttcttgtgacattgttaacttcagcaagaaagtaactttggtc |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
20862530 |
aaggtttttcttgtgacatgattaacttcaacaagaaagtaactttggtc |
20862579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University