View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_115 (Length: 207)
Name: NF9290_low_115
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_115 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 9807262 - 9807440
Alignment:
| Q |
13 |
tggacatcaaagttttaactaccaacactaacttgctattcgtaccacttgctccctaaattgtatcgttttaatgatgatcaaatgtccacgttcgcta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9807262 |
tggacatcaaagttttaactaccaacactaacttgctattcgtaccacttgctccctaaattgtatcgttttaatgatgatcaaatgtccatgttcgcta |
9807361 |
T |
|
| Q |
113 |
tgataaaatgagtatttggcaatagaggaacatctagtttgggatggcaaacatgaatcggttgacagcatgattattc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9807362 |
tgataaaatgagtatttggcaatagaggaacatctagtttgggatggcaaacatgaatcggttgacagcatgattattc |
9807440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University