View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_16 (Length: 428)
Name: NF9290_low_16
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 17 - 335
Target Start/End: Complemental strand, 36147517 - 36147199
Alignment:
| Q |
17 |
ctttggagataatgagagattttgaagatga---tgatggtgagaaagaagaggaagaggaaggtgaatttagtttagttgttgttgtggtggatgattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147517 |
ctttggagataatgagagattttgaagaagaagatgatggtgagaaagaagaggaagaggaaggtgaatttagtttagttgttgttgtggtggatgattt |
36147418 |
T |
 |
| Q |
114 |
gtcttgtgggaataatactaagagaagactcatgttgttgttgttggtggtggtggtgctgttatcttcgttggtagattttggctttgtcattgttgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147417 |
gtcttgtgggaataatactaagagaagactcatgttgttgttgttggtggtggtggtgctgttatcttcgttggtagattttggctttgtcattgttgag |
36147318 |
T |
 |
| Q |
214 |
agagaatcgtgggtgatgtttcttggtggtgatggttaatgggatgtgtgaaggagtggaaatgggaagtggtggggtatgaagtgaaaagaaggaacaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36147317 |
agagaatcgtgggtgatgtttcttggtggtgatggttaat-ggatgtgtgaaggagtggaaatggg-agtggtggggtatgaagtgaaaagaaggaacaa |
36147220 |
T |
 |
| Q |
314 |
atgtagtaagtaaatatgtaat |
335 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
36147219 |
atgtagt-agtaaatatgtaat |
36147199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 352 - 423
Target Start/End: Complemental strand, 36147171 - 36147100
Alignment:
| Q |
352 |
gttgatgttgagttgttattgatgtcttgctctgcttggggagatactgttgttgttgttgggtcctttgct |
423 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
36147171 |
gttgatgttgagttgttattcatgtcttgctctgcttggggagatactactgttgttgttgggtcatttgct |
36147100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University