View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_37 (Length: 358)
Name: NF9290_low_37
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 339
Target Start/End: Original strand, 2752405 - 2752763
Alignment:
| Q |
1 |
ctaacataactaagtgattggactcgggtgtttaacgagctctcctagtacgaatc--------------------gttttatggagaacccgagtttga |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2752405 |
ctaacataactaagtgattggactcgggtgtttaacgagctctcctagtacgaatcgttttatggagaacccaatcgttttatggagaacccgagtttga |
2752504 |
T |
 |
| Q |
81 |
tttctggagcgaactccaaccttatccaaaaaataaataaattacatcaacgctataaaggtacaccactatcataacttgcttcattagcaagcatgtg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2752505 |
tttctggagcgaactccaaccttatccaaaaaataaataaattacatcaacgctataaaggtacaccactgtcataacttgcttcattagcaagcatgtg |
2752604 |
T |
 |
| Q |
181 |
atgttatatcatcggtttaacatagttatatgcaacttggtatttataagcatcagtagaagcttcagattccactagaggtgagaccagttttgcaggc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2752605 |
atgttatatcatcggtttaacatagttatatgcaacttggtatttataagcatcagtagaagcttcagattccactagaggtgagaccagttttgcaggc |
2752704 |
T |
 |
| Q |
281 |
cataagcatgtgatggaatcattgacgatgagttgcagttgcggtctcatggacgtata |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2752705 |
cataagcatgtgatggaatcattgacgatgagttgcagttgcggtctcatggacgtata |
2752763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University