View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_46 (Length: 332)
Name: NF9290_low_46
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 314
Target Start/End: Complemental strand, 12312353 - 12312053
Alignment:
| Q |
14 |
atcaaagagttggctactgtcatagacaaaaattgtgtcacatgcaagataaatggggttcctaagggtatttgatatccttagtggaaagtctgattag |
113 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12312353 |
atcaaagaatcggctactgccatagacaaaaattgtgccacatgcaagataaatggggttcctaagggtatttgatatctttagtggaaagtctgattag |
12312254 |
T |
 |
| Q |
114 |
taggtttacattttcatcagttttttcttgcttaacagactgagcggacagtttctcataaatcttagcactttgagcagcgagttcagttttgatctct |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12312253 |
taggttttcattttcatcagttttttcttgcttaacagactgagcggacagtttctcataaatcctagcactttgagcagcgagttcagttttgatctct |
12312154 |
T |
 |
| Q |
214 |
tccttgaacctttcaaactcaatagcatatacagaagctgaaagatgaggttataatacaacagcaaaaatgatgaaatcttgtggtcttagaggcacaa |
313 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| |||||||||||| ||| |||||| |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
12312153 |
tccttgaacctttcaaactcaatggcatatacataagctaaaagatgaggttgtaacacaacaacaaaaatgatgaaatcttgtagtctcagaggcacaa |
12312054 |
T |
 |
| Q |
314 |
t |
314 |
Q |
| |
|
| |
|
|
| T |
12312053 |
t |
12312053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University