View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_61 (Length: 294)
Name: NF9290_low_61
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 276
Target Start/End: Original strand, 47027843 - 47028099
Alignment:
| Q |
19 |
cagagagttcagagagtctgtattgccttcaaaaactactgtgaggagaaaaacatagaagggtaagcttcaaaatatcatgtctaattttctgtatgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47027843 |
cagagagttcagagagtctgtattgccttcaaaaactactgtgaggagaaaaacatagaagggtaagcttcaaaatatcatgtctaattttctttatgtt |
47027942 |
T |
 |
| Q |
119 |
ttgaaaactctttggcaatacaatgttcatattctgataggaaaaaatatacatgnnnnnnnnnnnnnngcatttcaggtgctttaaaagcctgcaagac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47027943 |
ttgaaaactctttggcaatacaatgttcatattctgataggaaaaaatatacatg-ttttttttttgttgcatttcaggtgctttaaaagcctgcaagac |
47028041 |
T |
 |
| Q |
219 |
ataaagcaggagtataccttagtgaaaaccaagtttgagacactctttaaggtaagga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47028042 |
ataaagcaggagtataccttagtgaaaaccaagtttgagacactctttaaggtaagga |
47028099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University