View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_65 (Length: 269)
Name: NF9290_low_65
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 49023892 - 49024145
Alignment:
| Q |
1 |
taggaagaacatacaagctcagagagtgttgaaaaatgtttctgttccttcccacaactttgttttggagtatacctttctcacgctgcgaggttactac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49023892 |
taggaagaacatacaagctcagagagtgttgaaaaatgtttctgttccttcacacaactttgttttggagtatacctttctcacgctgcgaggttactac |
49023991 |
T |
 |
| Q |
101 |
cctgactctctggataaacaaaaccaagatagtttctgcattaggacggaaattcaaggtaacccaaatatccatttctttggtgtttttgatgggcatg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49023992 |
cctgactcgctggataaacaaaaccaagatagtttctgcattaggacggaaattcaaggtaacccaaatatccatttctttggtgtttttgatgggcatg |
49024091 |
T |
 |
| Q |
201 |
gtcaatttggtagtcaatgttcaaactttgttagagataggttggtagagaagt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49024092 |
gtcaatttggtagtcaatgttcaaactttgttagagataggttggtagagaagt |
49024145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 116 - 202
Target Start/End: Complemental strand, 49903403 - 49903317
Alignment:
| Q |
116 |
aaacaaaaccaagatagtttctgcattaggacggaaattcaaggtaacccaaatatccatttctttggtgtttttgatgggcatggt |
202 |
Q |
| |
|
|||||||| || ||||||| |||| |||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
49903403 |
aaacaaaaacatgatagttcttgcaataggacggaaattcaaggtaacccgaatatccatttatttggtgtttttgttgggcatggt |
49903317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University