View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_66 (Length: 269)
Name: NF9290_low_66
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 14038998 - 14039216
Alignment:
| Q |
19 |
ggttattcatgatgaaaagtggcaagtcataccctaccaaattcaccacaaaaacaccatcaaaacaaaagaaataataacaccaattctaacattgttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
14038998 |
ggttattcatgatgaaaagtggcaagtcataccctaccaaattcaccacaaaaacaccatcaaaacaaaagaaataataacaacaatcctaacattgttg |
14039097 |
T |
|
| Q |
119 |
gctgtgaagttcacatgtcccccagatgtatccatctcctcaggcagtggagatttctcgttcccagactcgatcgaacttgttggagatttctcgttcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14039098 |
gctgtgaagttcacatgtcccccagatatatccatctcctcaggcagtggagatttctcgttcccagactcgatcggacttgttggagatttctcgttcc |
14039197 |
T |
|
| Q |
219 |
cggactggatcgaacttgt |
237 |
Q |
| |
|
| || | ||||| |||||| |
|
|
| T |
14039198 |
cagattcgatcggacttgt |
14039216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 166 - 261
Target Start/End: Original strand, 14039181 - 14039276
Alignment:
| Q |
166 |
tggagatttctcgttcccagactcgatcgaacttgttggagatttctcgttcccggactggatcgaacttgtgggacaaaaagtgatagtataatc |
261 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14039181 |
tggagatttctcgttcccagattcgatcggacttgttggagatttctcgttcccggactggatcgaacttgtgggacaaaaagtgatagtataatc |
14039276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University