View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_68 (Length: 259)
Name: NF9290_low_68
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 49023901 - 49023800
Alignment:
| Q |
1 |
gttcttcctatggctatgatgataaccaagttttctagagacgccatccgaagatttcagacagcaacatttaccatgaacacaacccatgtttcaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49023901 |
gttcttcctatggctatgatgataaccaagttttctagagacgccacccgaagatttcagacagcaacatttaccatgaacacaacccatgtttcaaaca |
49023802 |
T |
|
| Q |
101 |
gg |
102 |
Q |
| |
|
|| |
|
|
| T |
49023801 |
gg |
49023800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 248
Target Start/End: Complemental strand, 49023759 - 49023671
Alignment:
| Q |
158 |
ttgttgtaaacaagacatgaaaccgaaagcattgnnnnnnnnnnncaaaagtttacaggaagttgtaactcctctgcaatgtaacaccaaa |
248 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49023759 |
ttgttataaacaagacatgaaaccgaaagcattgaaagaaaaaa--aaaagtttacaggaagttgtaactcctctgcaatgtaactccaaa |
49023671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University