View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_69 (Length: 253)
Name: NF9290_low_69
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_69 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 127 - 253
Target Start/End: Original strand, 45547073 - 45547199
Alignment:
| Q |
127 |
tcctaatcatgttaggtctaaattttagataattagtttgtttgacttataaaatcatttttggtcatatttggtgcaagagtacttatatagttgatat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45547073 |
tcctaatcatgttaggtctaaattttagataattagtttgtttgacttataaaatcatttttggtcatatttggtgcaagagtacttatatagttgatat |
45547172 |
T |
|
| Q |
227 |
gcaaggataaaaatcaatatagtctac |
253 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45547173 |
gcaaggataaaaatcaatatagtctac |
45547199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 67
Target Start/End: Original strand, 45546961 - 45547015
Alignment:
| Q |
13 |
attatactgtcttagtctatctaatttttgtttgtgagaaaattcatactcaatc |
67 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546961 |
attattctgtcttagtctatctaatttttgtttgtgagaaaattcatactcaatc |
45547015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University