View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_71 (Length: 251)
Name: NF9290_low_71
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 238
Target Start/End: Complemental strand, 37787533 - 37787298
Alignment:
| Q |
3 |
ctccaacaatttacaaatcgaaaaattcttctctggaagatattgtttgcgatctcaattacttcttacaacataatttgttttcttcggttcttttcct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37787533 |
ctccaacaatttacaaatcgaaaaattcttctcttgaagatactgtttgcgatctcaattacttcttacaacataattttttttcttcggttcttttcct |
37787434 |
T |
|
| Q |
103 |
ctttcatctcgtcgtttttcaaatcaagggtcgttttcttcttgggttcatcaagatgattttgccaggtgtgttcattcaaggtatcgttttgtgactg |
202 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37787433 |
ctttcatctcgtcgtttttcaaataaagggtcgttttcttcttgggttcatcaagatgattttgccaggtgtgttcattcaaggtatcgttttgtgactg |
37787334 |
T |
|
| Q |
203 |
tcattattctattctatgaagagagttgtttcgtct |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37787333 |
tcattattctattctatgaagaaagttgtttcgtct |
37787298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University