View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_90 (Length: 239)
Name: NF9290_low_90
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_90 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 45547532 - 45547358
Alignment:
| Q |
18 |
aatttgaatttgaatatgtgattgttagttagttaacaacgttatgatcatcattttctcgcaggagtcaattgcaaaacagattaacgaaaacccagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45547532 |
aatttgaatttgaatatgtgattgttagttagttaacaacgttatgatcatcattttctcgcaggagtcaattgcaaaacagattaacgaaaacccagag |
45547433 |
T |
|
| Q |
118 |
gcaggatgggaggctgctattaatcctcgtttctccaactttacggttacacacactctctccaaatatacaacc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45547432 |
gcaggatgggaggctgctattaatcctcgtttctccaactttacggttacacacactctctccaaatatacaacc |
45547358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 73 - 169
Target Start/End: Complemental strand, 45540259 - 45540163
Alignment:
| Q |
73 |
ttctcgcaggagtcaattgcaaaacagattaacgaaaacccagaggcaggatgggaggctgctattaatcctcgtttctccaactttacggttacac |
169 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| || ||||||||||||| |
|
|
| T |
45540259 |
ttctcgcaggagtctattgctagacagattaacgaaaacccagaggcaggatgggaagctacaattaatcctcgtttctcaaattttacggttacac |
45540163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University