View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9290_low_97 (Length: 236)
Name: NF9290_low_97
Description: NF9290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9290_low_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 47538123 - 47537902
Alignment:
| Q |
1 |
acagtaaaaaatttagtccatacatcccagttaggccaacaaagaacagaatattagcaactcagactacaacatacgtggttgtcattgaacttgtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47538123 |
acagtaaaaaatttagtccatacatcccagttaggccaacaa-gaacagaatattagcaactcagactacaacatacgtggttgtcattgaacttgtcaa |
47538025 |
T |
|
| Q |
101 |
tggaaaggaaggaaataattaatgaaagaaactcagcgttcgcgtgcccctgttcttgtgcctgcctataggcatgtttggtacaccagtaatcatacat |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47538024 |
tggaaaggaaggaaataatgaatgaaagaaactcaccgttcgcgtgcccctgttcttgtgcctgcctataggcatgtttggtacaccagtaatcatacat |
47537925 |
T |
|
| Q |
201 |
aaatactttaaatgcctatatag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47537924 |
aaatactttaaatgcctatatag |
47537902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 47545311 - 47545251
Alignment:
| Q |
145 |
tgcccctgttcttgtgcctgcctataggcatgtttggtacaccagtaatcatacataaata |
205 |
Q |
| |
|
||||| |||| | |||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
47545311 |
tgcccatgttttcgtgcctgcctataggcctgtttggtacaccactaatcttacataaata |
47545251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University