View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9291_low_15 (Length: 282)
Name: NF9291_low_15
Description: NF9291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9291_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 13375941 - 13376200
Alignment:
| Q |
17 |
attatttggtatggaatgatcaaactatattaggacattgagcaaacacaaatttcataaactacaaaatcatccaacgaaagattgttgaacatacaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13375941 |
attatttggtatggaatgatcaaactatattaggacattgagcaaacacaaatttcataaactacaaaatcatccaacgaaagattgttgaacatacaaa |
13376040 |
T |
 |
| Q |
117 |
tcaaattagtttaaatcaaaatgattattattgatgtttcttaaaatannnnnnncacaaaaacggaatgagatgaagt--------gtgtacctttcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
13376041 |
tcaaattagtttaaatcaaaatgattattattgatgtttcttaaaatatttttttcacaaaaacggaatgagatgaagtgccaacaagtgtacc-ttcta |
13376139 |
T |
 |
| Q |
209 |
ccacatcaaagcgaacaacgaagaccaattgtttctcaacaatgcataatgccacatagta |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13376140 |
ccacatcaaagtgaacaacgaagaccaattgtttctcaacaatgcataatgccacatagta |
13376200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University