View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9291_low_20 (Length: 257)
Name: NF9291_low_20
Description: NF9291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9291_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 24120486 - 24120715
Alignment:
| Q |
1 |
cgatatacatgctaaatgaatattgatgataaatatatagaatcaaaatccagacttcagagtattttgcaggaaacagaacataaaaatgatctaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||| ||||||||| |||| |
|
|
| T |
24120486 |
cgatatacatgctaaatgaatattgatgataaatatatagaaacaaaatccagatttcagagtattttgcaggaaacacaacatagaaatgatcttatag |
24120585 |
T |
 |
| Q |
101 |
tgtctaactactgacatgtattatagtttaacataataata-nnnnnnnatgcaagaagtgtataaaaccaatgatttgaatgtttcttttataaatact |
199 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24120586 |
tg--------ctgacatgtattataatttaacataataatattttttttatgcaacaagtgtataaaaccaatgatttgaatgtttcttttataaatact |
24120677 |
T |
 |
| Q |
200 |
aatgtaaagttttgttttgttgaatgttgtaccaacct |
237 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
24120678 |
aatataaagttttgttttgttgaatgttgtactaacct |
24120715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University