View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9291_low_29 (Length: 241)

Name: NF9291_low_29
Description: NF9291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9291_low_29
NF9291_low_29
[»] chr1 (2 HSPs)
chr1 (1-76)||(45127082-45127157)
chr1 (174-225)||(45127541-45127591)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 45127082 - 45127157
Alignment:
1 tgattggaattgagcatgatatatactgtcccttcatttggacaacattgatgaagttcgttattatctaagctag 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45127082 tgattggaattgagcatgatatatactgtcccttcatttggacaacattgatgaagttcgttattatctaagctag 45127157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 45127541 - 45127591
Alignment:
174 cgggcttaattaatggctcattagttcatagttttacaataaagggatggct 225  Q
    ||||||||||||||||||||||||||||||| || |||||||||||||||||    
45127541 cgggcttaattaatggctcattagttcatag-ttaacaataaagggatggct 45127591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University