View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9291_low_29 (Length: 241)
Name: NF9291_low_29
Description: NF9291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9291_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 45127082 - 45127157
Alignment:
| Q |
1 |
tgattggaattgagcatgatatatactgtcccttcatttggacaacattgatgaagttcgttattatctaagctag |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127082 |
tgattggaattgagcatgatatatactgtcccttcatttggacaacattgatgaagttcgttattatctaagctag |
45127157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 45127541 - 45127591
Alignment:
| Q |
174 |
cgggcttaattaatggctcattagttcatagttttacaataaagggatggct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
45127541 |
cgggcttaattaatggctcattagttcatag-ttaacaataaagggatggct |
45127591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University