View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9291_low_32 (Length: 239)
Name: NF9291_low_32
Description: NF9291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9291_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 224
Target Start/End: Complemental strand, 31223413 - 31223203
Alignment:
| Q |
14 |
attgcaatgtcatatgaacnnnnnnngaacaagtgatttcaaattctcataaaatgcaaaccaagggtgtattaatttttacctgaaagacaccaaactc |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31223413 |
attgcaatgtcatatgaacaaaaaaagaacaagtgatttcaaattctcatgaaatgcaaaccaagggtgtattaatttttacctgaaagacaccaaactc |
31223314 |
T |
 |
| Q |
114 |
cttgcaagcaattcgaatttcgttgatcgtttgagatctaagagattgttcccttaaattagacaagtctataatgggaagagtggtggagatggaaaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31223313 |
cttgcaagcaattcgaatttcgttgatcgtttgagatctaagagattgttcccttaaattagacaagtctataatgggaagagtggtggagatggaaaca |
31223214 |
T |
 |
| Q |
214 |
tgatcataagt |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
31223213 |
tgatcataagt |
31223203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University