View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9291_low_9 (Length: 403)
Name: NF9291_low_9
Description: NF9291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9291_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 19 - 387
Target Start/End: Original strand, 16005533 - 16005916
Alignment:
| Q |
19 |
ttccccgtgttgcacaagggtgtgccatctcttctaaagtgtatgtgaatggttacattgattcatatcatgctggtttcgatgctggcctaaatgcagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16005533 |
ttccccgtgttgcacaagggtgtgccatctcttctaaagtgtatgtgaatggttacattgattcatatcatgctggtttcgatgctggcctaaatgcagt |
16005632 |
T |
 |
| Q |
119 |
tccatatgagggtgcttatgaaaaaatgcgaggaatgcatgatgggttagcagctggtcaacttgctcaagatgaaaatgcacagattgcacatgatgtt |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16005633 |
tccatatgagggtgcttatgaaataatgcgaggaatgcatgatgggttagcagctggtcaacttgctcaagatgaaaatgcacagattgcacatgttgtt |
16005732 |
T |
 |
| Q |
219 |
ggggcaaatcaagcacaagaagttgcagaaaatcttgacgcagaagaaaatgcac---------------aggtagaacaagctgaagaagttgcacaga |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16005733 |
ggggcaaatcaagcacaagaagttgtagaaaatcttgaggcagaagaaaatgcacaggttgatgatattgaggtagaacaagctgaagaagttgcacaga |
16005832 |
T |
 |
| Q |
304 |
atctggaggctgaacaagatgaagtttgatttgatattttttccatgactttactttagtttctttcccgagagatatttgtgc |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16005833 |
atctggaggctgaacaagatgaagtttgatttgatatttttgccatgactttactttagtttctttcccaagagatatttgtgc |
16005916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University