View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9292_low_9 (Length: 275)
Name: NF9292_low_9
Description: NF9292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9292_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 2757491 - 2757691
Alignment:
| Q |
17 |
ctatttgccttccacttttttaatatagtagattatacgtgtttttctctaccnnnnnnnnnnngaatatacgtgnnnnnnnnaatgatattacacctcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
2757491 |
ctatttgccttccacttttttaatatagtagattatacgtgtttttctctaccaaaaaaaaaa-gaatatacgtgttttttttaatgatattacacctcc |
2757589 |
T |
 |
| Q |
117 |
cttgttttcaactaaataaattgttttgtctattcccctnnnnnnnnnttgttttgtctattatcccttctctagttaacaatgcatataataattctta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757590 |
cttgttttcaactaaataaattgttttgtctattcccctaaaaaaaaattgttttgtctgttatcccttctctagttaacaatgcatataataattctta |
2757689 |
T |
 |
| Q |
217 |
tt |
218 |
Q |
| |
|
|| |
|
|
| T |
2757690 |
tt |
2757691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University