View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9293_high_4 (Length: 256)
Name: NF9293_high_4
Description: NF9293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9293_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 163 - 242
Target Start/End: Original strand, 31321264 - 31321343
Alignment:
| Q |
163 |
cgattgatttatgtcccttaaaccccctttctagctcaaaatactaacttggatattagagtgtttgcggttacaccacc |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31321264 |
cgattgatttctgtcccttaaaccccctttctagctcaaaatactaacttgggtattagagtgtttgcggttacaccacc |
31321343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 47 - 113
Target Start/End: Original strand, 31321200 - 31321266
Alignment:
| Q |
47 |
tgcctccatcattgcaaactagtaacactttacagtcggtgaacaactacatacgtcaaaataccga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
31321200 |
tgcctccatcattgcaaactagtaacactttacagtcgaggaacaacaacatacgtcaaaataccga |
31321266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 31328986 - 31329044
Alignment:
| Q |
114 |
caacctgcacctccttatacaaggagacttgaacggtctcctcaaggtacgattgattt |
172 |
Q |
| |
|
|||||||||||||| | ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
31328986 |
caacctgcacctccctgtacaaggagacttaaagagtctcctcaaggtacgattgattt |
31329044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University