View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9293_low_19 (Length: 257)
Name: NF9293_low_19
Description: NF9293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9293_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 17164872 - 17164952
Alignment:
| Q |
10 |
gcagagacatagcaaggttaaaagagaattatagttatcacaattatcatactatgcatttcagccatcctcatactatta |
90 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17164872 |
gcagagacatattaaggttaaaagagaattatagttatcacaattatcatactatgcatttcagccatcctcatactatta |
17164952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 118
Target Start/End: Complemental strand, 28007820 - 28007784
Alignment:
| Q |
82 |
atactattattttcaaatctttagtaatcatagtctc |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28007820 |
atactattatttctaaatctttagtaatcatagtctc |
28007784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University