View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9293_low_20 (Length: 257)

Name: NF9293_low_20
Description: NF9293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9293_low_20
NF9293_low_20
[»] chr2 (1 HSPs)
chr2 (10-90)||(17164872-17164952)
[»] chr3 (1 HSPs)
chr3 (82-118)||(28007784-28007820)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 17164872 - 17164952
Alignment:
10 gcagagacatagcaaggttaaaagagaattatagttatcacaattatcatactatgcatttcagccatcctcatactatta 90  Q
    |||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17164872 gcagagacatattaaggttaaaagagaattatagttatcacaattatcatactatgcatttcagccatcctcatactatta 17164952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 118
Target Start/End: Complemental strand, 28007820 - 28007784
Alignment:
82 atactattattttcaaatctttagtaatcatagtctc 118  Q
    ||||||||||||  |||||||||||||||||||||||    
28007820 atactattatttctaaatctttagtaatcatagtctc 28007784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University