View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9294_low_2 (Length: 207)

Name: NF9294_low_2
Description: NF9294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9294_low_2
NF9294_low_2
[»] chr7 (1 HSPs)
chr7 (37-192)||(11746240-11746395)
[»] chr8 (2 HSPs)
chr8 (28-196)||(43320753-43320921)
chr8 (28-196)||(7124494-7124660)
[»] scaffold0050 (1 HSPs)
scaffold0050 (66-196)||(14631-14761)
[»] chr2 (2 HSPs)
chr2 (131-196)||(27265884-27265949)
chr2 (149-196)||(43447925-43447972)


Alignment Details
Target: chr7 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 37 - 192
Target Start/End: Original strand, 11746240 - 11746395
Alignment:
37 tgccacagtacacatatcttcatgtgacatagcagtcctcccatcatccgagtggagcttactatccttcttcactttgccacggactaccgcggatgta 136  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||     
11746240 tgccacaatacacatatcttcatttgacatagcagtcctcccatcatccgagtggagcttactatccttcttcactttgccacgggctatcgcggatgtt 11746339  T
137 tgaaagaactttgtattcatgtccccttccttcaaccagtggattttcgctctctg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
11746340 tgaaagaactttgtattcatgtccccttccttcaaccagtggattttccctctctg 11746395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 28 - 196
Target Start/End: Original strand, 43320753 - 43320921
Alignment:
28 ataaccttgtgccacagtacacatatcttcatgtgacatagcagtcctcccatcatccgagtggagcttactatccttcttcactttgccacggactacc 127  Q
    ||||| |||||||||  |||||||||| || |||| | || | ||  |||||||||||| | ||||||||||| |||||||||||||||||||| ||| |    
43320753 ataactttgtgccacgttacacatatcctcctgtgtcgtatctgttatcccatcatccgtgcggagcttactaaccttcttcactttgccacgggctatc 43320852  T
128 gcggatgtatgaaagaactttgtattcatgtccccttccttcaaccagtggattttcgctctctgcttc 196  Q
    || ||||||||||||||||| ||||| || ||||||||||||||||| || |||||| |||| ||||||    
43320853 gctgatgtatgaaagaacttagtatttatatccccttccttcaaccaatgcattttcactctttgcttc 43320921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 28 - 196
Target Start/End: Complemental strand, 7124660 - 7124494
Alignment:
28 ataaccttgtgccacagtacacatatcttcatgtgacatagcagtcctcccatcatccgagtggagcttactatccttcttcactttgccacggactacc 127  Q
    |||| ||||||||||  |||||||||| |  || ||  |||| |||||||||||||| | | ||||||||||| ||||||||| |||||||||| ||| |    
7124660 ataaacttgtgccacgttacacatatccttttgcgatgtagccgtcctcccatcatctgtgcggagcttactaaccttcttcaatttgccacgggctatc 7124561  T
128 gcggatgtatgaaagaactttgtattcatgtccccttccttcaaccagtggattttcgctctctgcttc 196  Q
     | |||  |||||||||||| |||||||| |||||||||||||||||||| ||||| ||||| ||||||    
7124560 actgat--atgaaagaacttagtattcatatccccttccttcaaccagtgcatttttgctctttgcttc 7124494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 66 - 196
Target Start/End: Complemental strand, 14761 - 14631
Alignment:
66 tagcagtcctcccatcatccgagtggagcttactatccttcttcactttgccacggactaccgcggatgtatgaaagaactttgtattcatgtccccttc 165  Q
    |||| |||||||||||||| | | ||||||||||| ||||||||||||||||| || ||| ||| ||||||||||||||||| |||||||| ||||||||    
14761 tagccgtcctcccatcatctgtgcggagcttactaaccttcttcactttgccatgggctatcgctgatgtatgaaagaacttagtattcatatccccttc 14662  T
166 cttcaaccagtggattttcgctctctgcttc 196  Q
    ||||||| |||| |||||| |||| ||||||    
14661 cttcaactagtgcattttcactctttgcttc 14631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 131 - 196
Target Start/End: Complemental strand, 27265949 - 27265884
Alignment:
131 gatgtatgaaagaactttgtattcatgtccccttccttcaaccagtggattttcgctctctgcttc 196  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||| |||||  |||| ||||||    
27265949 gatgtatgaaagaacttagtattcatgtccccttccttcaactagtgcattttttctctttgcttc 27265884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 43447972 - 43447925
Alignment:
149 gtattcatgtccccttccttcaaccagtggattttcgctctctgcttc 196  Q
    |||| |||||||||||||||||||||||| ||||||||| | ||||||    
43447972 gtatccatgtccccttccttcaaccagtgcattttcgctatttgcttc 43447925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University