View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9296_high_6 (Length: 247)
Name: NF9296_high_6
Description: NF9296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9296_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 32914548 - 32914755
Alignment:
| Q |
18 |
atcaacttgaaacagtatataataaataatctacaaaatataaagggaagaataaagatatgagtaggaaattggaagagaatttcataatagaaaggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914548 |
atcaacttgaaacagtatataataaataatctacaaaatataaagggaagaataaagatatgagtaggaaattggaagagaatttcataatagaaaggtt |
32914647 |
T |
|
| Q |
118 |
cagaatatcaagtttaccttgtatgtcttctttgtttcagctgatgttagtgttgcctcgcatgactgcttctggctaattataggtgtcgtggggttgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32914648 |
cagaatatcaagtttaccttgtatgtcttctttgtttcagctgatgttagtgttgcctcgcatgactgcttctggctaattttaggtgtcgtggggttgg |
32914747 |
T |
|
| Q |
218 |
aaggttcg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
32914748 |
aaggttcg |
32914755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University