View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9296_low_23 (Length: 242)
Name: NF9296_low_23
Description: NF9296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9296_low_23 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 24820140 - 24820255
Alignment:
| Q |
127 |
agtcttggttccattttctttactaaaattatcatcttggaaattaaacatgaatgcacaagactgtactataacgagatttaatgtcatagagttagat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820140 |
agtcttggttccattttctttactaaaattatcatcttggaaattgaacatgaatgcacaagactgtactataacgagatttaatgtcatagagttagat |
24820239 |
T |
|
| Q |
227 |
tttaatgggtactact |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24820240 |
tttaatgggtactact |
24820255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 24820038 - 24820079
Alignment:
| Q |
18 |
gctagattatactttcaacatgattttcttcactaattctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820038 |
gctagattatactttcaacatgattttcttcactaattctcc |
24820079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University