View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9296_low_29 (Length: 227)
Name: NF9296_low_29
Description: NF9296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9296_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 2 - 201
Target Start/End: Complemental strand, 35424005 - 35423811
Alignment:
| Q |
2 |
gtcttcaacattttgtattccaaaatacttgtttggaggtttgctacataaatggaactttttaataattgtcagatatttgtcaaaataattataataa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35424005 |
gtcttcaacattttgtattccaaaatacttgtttggaggtttgctacataaatggagcattttaataattgtcagatatttgtcaaaataattataataa |
35423906 |
T |
 |
| Q |
102 |
ttgcgagttcagactagacaagacaagtgtgggtggatcatgaagtattgaaaattttcactaacgacttatttaaaattttgttgggagccggtcctag |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35423905 |
ttgcgagttcagactaga-----caagtgtgggtggatcatgaggtattgaaaaatttcactaacgacttatttaaaattttgtcgggagccggtcctag |
35423811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University