View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9296_low_30 (Length: 226)
Name: NF9296_low_30
Description: NF9296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9296_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 21384449 - 21384655
Alignment:
| Q |
1 |
gagaaattctttatggagaagctcagagtctttgccgagagcagccacggtgaaagtggggccgtcgggggagagcggaggatgagagagagatgatatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
21384449 |
gagaaattctttatggagaagctcagagtctttgccgagagcagccacggtgaaagtggggccgtcgacggagagtggaggatgagagagagatgatatg |
21384548 |
T |
 |
| Q |
101 |
gcttggtggaaggattagattgcggtgcgggaagtgaaagcaatggcggagaaggggtctagagagtgaggagagagatagggggaaaaggtagatggag |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21384549 |
gcttggtggaaggattggattgcggtgcgggaggtgaaagcaatggcggagaaggggtctagagagtgaggagagagataaggggaaaaggtagatggag |
21384648 |
T |
 |
| Q |
201 |
tgggttg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
21384649 |
tgggttg |
21384655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University