View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9296_low_31 (Length: 226)

Name: NF9296_low_31
Description: NF9296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9296_low_31
NF9296_low_31
[»] chr1 (1 HSPs)
chr1 (1-207)||(21384449-21384655)


Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 21384449 - 21384655
Alignment:
1 gagaaattctttatggagaagctcagagtctttgccgagagcagccacggtgaaagtggggccgtcgggggagagcggaggatgagagagagatgatatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| ||||||||||||||||||||||||    
21384449 gagaaattctttatggagaagctcagagtctttgccgagagcagccacggtgaaagtggggccgtcgacggagagtggaggatgagagagagatgatatg 21384548  T
101 gcttggtggaaggattagattgcggtgcgggaagtgaaagcaatggcggagaaggggtctagagagtgaggagagagatagggggaaaaggtagatggag 200  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
21384549 gcttggtggaaggattggattgcggtgcgggaggtgaaagcaatggcggagaaggggtctagagagtgaggagagagataaggggaaaaggtagatggag 21384648  T
201 tgggttg 207  Q
    |||||||    
21384649 tgggttg 21384655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University