View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9296_low_8 (Length: 374)
Name: NF9296_low_8
Description: NF9296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9296_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 33554726 - 33554915
Alignment:
| Q |
1 |
tataacatatgttcttaagcatgtaagaactacatcccatgtaaccnnnnnnncgacatgaaagtatagtttcatacattgcatatataaatttcgactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33554726 |
tataacatatgttcttaagcatgtaagatctacatcccatgtaaccaaaaaaacgacatgaaagtatagtttcatacattgcatatataaat---gactg |
33554822 |
T |
|
| Q |
101 |
aactcacacaaacaaatttcgatttgcaacatctaatgcttctggagctcccccaccatcacctctctgaatgcacaatcaactgatccattc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554823 |
aactcacacaaacaaatttcgatttgcaacatctaatgcttctggagctcccccaccatcacctctctgaatgcacaatcaactgatccattc |
33554915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 251 - 357
Target Start/End: Original strand, 33554983 - 33555089
Alignment:
| Q |
251 |
gtaccttgtaaaagtctacagcaatgtagttaggccatcggttaccagcatctttatagcaagtatgcatctttcgaatcaatggggatgagttatccct |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33554983 |
gtaccttgtaaaagtctacagcaatgtagttaggccatcggttaccagcatctttatagcaagtatgcatctttcgaatcaatggggatgagttatcctt |
33555082 |
T |
|
| Q |
351 |
acatgct |
357 |
Q |
| |
|
||||||| |
|
|
| T |
33555083 |
acatgct |
33555089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University