View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9297_high_13 (Length: 201)
Name: NF9297_high_13
Description: NF9297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9297_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 9291637 - 9291593
Alignment:
| Q |
19 |
atcataatctgctaactataaagatactggaagaggatagattac |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9291637 |
atcataatctgctaactataaagatactggaagaggatagattac |
9291593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 9291516 - 9291469
Alignment:
| Q |
140 |
gcagaagtaatcatcactgggcggtagttattagaattattctgtgct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9291516 |
gcagaagtaatcatcactgggcggtagttattagaatttttctgtgct |
9291469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University