View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9297_low_12 (Length: 339)
Name: NF9297_low_12
Description: NF9297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9297_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 170 - 326
Target Start/End: Complemental strand, 47285637 - 47285481
Alignment:
| Q |
170 |
gacagtaaatctgcatgaaggataggtctgtagctgcttgagttgttgttatggttataattagtgtgaagcaaaagaaaacatagacagtggtagagaa |
269 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285637 |
gacagtaactctggatgaaggataggtctgtagctgcttgagttgttattatggttataattagtgtgaagcaaaagaaaacatagacagtggtagagaa |
47285538 |
T |
|
| Q |
270 |
tttgaagtggtgcagcatttgtttttgatggatcatgttttttgctcttgatgttct |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285537 |
tttgaagtggtgcagcatttgtttttgatggatcatgttttttgctcttgatgttct |
47285481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 47285789 - 47285699
Alignment:
| Q |
18 |
aaaggcaccgtacacggtgtttacagggttgttggcgccaactgtggtgtagtagaaaccatttttgtttgtggaattgggtgaaagaata |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
47285789 |
aaaggcaccgtacacggtgtttacggggttgttggcgccaactgtggtgtagtagaaaccatttttgtttgtggagttggatgaaagaata |
47285699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University