View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9297_low_19 (Length: 249)

Name: NF9297_low_19
Description: NF9297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9297_low_19
NF9297_low_19
[»] chr1 (1 HSPs)
chr1 (1-249)||(19268532-19268780)


Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 19268532 - 19268780
Alignment:
1 gatgtaaaacagaatataaaaactagaaagaaagaggaacatatcaagaagctaccgtttaatttaaagcctataatcattcctaccgttgctcgcacaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
19268532 gatgtaaaacagaatataaaaactagaaagaaagaggaacagatcaagaagctaccgtttaatttaaagactataatcattcctaccgttactcgcacaa 19268631  T
101 atatgatattttagggtttaagagatttagaagaaagaacaaattagggaggaaaaaatagtggcagaacaaatcgagcaagaaacgacatcagcatgga 200  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||| |||||    
19268632 atatgatatttcagggtttaagagatttagaagaaagaacaaattagggatgaaaaaacagtggcagaacaaatcgatcaagaaacgacatcagtatgga 19268731  T
201 tcgcttgcaagacgttgaagctgacagcaaaggaaggctacatggatgt 249  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||    
19268732 tcgcttgcaagacgttgaagctgacagcaaaggaaggccacatggatgt 19268780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University