View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9297_low_25 (Length: 210)
Name: NF9297_low_25
Description: NF9297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9297_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 7 - 141
Target Start/End: Original strand, 43978533 - 43978667
Alignment:
| Q |
7 |
aaataagccagaggtttttctgcactaaccgattattccaataatggttcttattaaataagtgtcaaccatggctgcaaaattcaaagaagaagctgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43978533 |
aaataagccagaggtttttctgcactaaccgattattccaataatggttcttattaaataagtgtctaccatggctgcaaaattcaaagaagaagctgaa |
43978632 |
T |
|
| Q |
107 |
gaaagacgatgtaaacaaatgaagaatgcttctcc |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
43978633 |
gaaagacgatgtaaacaaatgaagaatgtttctcc |
43978667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University