View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9297_low_29 (Length: 201)

Name: NF9297_low_29
Description: NF9297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9297_low_29
NF9297_low_29
[»] chr5 (2 HSPs)
chr5 (19-63)||(9291593-9291637)
chr5 (140-187)||(9291469-9291516)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 9291637 - 9291593
Alignment:
19 atcataatctgctaactataaagatactggaagaggatagattac 63  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
9291637 atcataatctgctaactataaagatactggaagaggatagattac 9291593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 9291516 - 9291469
Alignment:
140 gcagaagtaatcatcactgggcggtagttattagaattattctgtgct 187  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||    
9291516 gcagaagtaatcatcactgggcggtagttattagaatttttctgtgct 9291469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University