View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9298_low_15 (Length: 251)
Name: NF9298_low_15
Description: NF9298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9298_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 37853044 - 37852814
Alignment:
| Q |
7 |
tttggtgttgttattttgtttgaggatttccccccaaatgtaggtcacatgatctgacaaactgtgtcataaattcataatttattgcatattagtagta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37853044 |
tttggtgttgttattttgtttgaggatttccccccaaatgtaggtaacatgatctgacaaactgtgtcataaattcataatttattgcatattagtagta |
37852945 |
T |
|
| Q |
107 |
t--gttgttgaaatacttaagcaagctgagtcgttccgcatagacatatcatagtgatatgtatttggcatctctggtgtgatgtcttctttcaaagnnn |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37852944 |
tatgttgttgaaatacttaagcaagctgagtcgttccgcatagacatatcatagtgatatgtatttggcatctctggtgtgatgtcttctttcaaagaaa |
37852845 |
T |
|
| Q |
205 |
nnnngaaagaaagatcacagttgataatatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37852844 |
aaaagaaagaaagatcacagttgataatatt |
37852814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University